Finance- If 8 year from now you want to give a

down payment of 10,000 to buy a house. How much you need to deposit today to achieve your goal, if you are offered an annual compounded yield of 7%.You deposit $20,000 today in a bank account that pays 8% compounded annually, ¿which amount you can withdraw each year and at the end of 5 years the ending balance is 0?If it is increased the number of times that the interest be composed during a period , the terminal value of a quantity will be lower: True or False

Oletyou seleforit $ x today.So ,* will be afta 8 year70 0soat a rat of For .je . ,x (1 7 0.07 )= 100 0010000X- $ 58 20 . 09( 1 .07 ) 8Mears you have to defforit today $ 58 20As .Let…

 

"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Hi, I have a case report to do, below I have attached the photo of the last issue where Im confused on what the issue actually was. With that anonymous letter, does it mean that horizon felt they where treated unfair because of Gemmas’ decision as she will determine horizon’s user friendliness and capabilities according to other people’s mouth of words?

• Attachment 1
• Attachment 2

" Finally , we have major issue that needs to be addressed . Gemma Nyoman , our softwaremanager , is requesting to attend a users’ conference in Phuket . Normally she attends quitea few of these a year as she is responsible for identifying the right software for us . ""We are currently in process of replacing our CAD-CAM* software and we have receivedbids from six different software firms . Gemma is reviewing these bids and will ultimately*make a decision on which bid to proceed with . "" Horizon 1 – 2 – 3 is an aggressive software developer . Every six months , Horizon has a three -day users’ conference in South East Asia . Each conference has substantial time allowed for*" rest and recreation " . Horizon has offered Gemma an all – expenses – paid visit to the upcoming*conference in Phuket , Thailand . Gemma believes it will be very useful to talk to other usersof Horizon software , to determine its user friendliness and capabilities . She is especially*looking forward to the visit because she has close relatives in the Phuket area . "" Now normally , I would just let her go on the conference . However , I have received ananonymous letter arguing that Horizon is receiving unfair , favourable treatment in oursoftware decision – making process . The letter specifically mentions Gemma’s upcoming " all -expenses – paid package to Phuket during Australia’s cold winter ". "

 

"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

FINALLY, I want you each to create “Experimental stem question” similar to those I created about.

1.    Hypothesis:

2.    Type I and Type II Error

a.    Type I Error:

b.    Type II Error:

Example:

In 1999, 55.1% of high school students in the U.S. played on a high school sports team. You think this percentage changed.

 

"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

• Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon.  You will notice that the second strand has a point deletion  (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.

•  
  • aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

•  
  • aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc

 

"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"