I Will Pay For The Following Essay Gattaca A Movie Review The Essay Is To Be 3 P

I will pay for the following essay Gattaca: A Movie Review. The essay is to be 3 pages with three to five sources, with in-text citations and a reference page.

This decision was stimulated when they had the blood of their first son, Vincent, tested for genetic abnormalities which got them the conclusion from doctors that Vincent was going to die at an early age because of a terminal heart condition (Gattaca, n.d.). As a natural reaction, parents wanting only the best for their child, both felt the need to do whatever it takes so as this does not happen to their second child, where they have seen science and technology as instruments in serving their duty as parents well of giving their children the best that life has to offer. Because of this clean motive to promote the betterment of their second child, they have forgotten about the issues that genetic engineering might bring in the aspect of morality and religion. However, I still believe that the means does not justify the end.

Gattaca, though was a movie that tickles the boundaries of the mind and challenges technophobia or the resistance to new technology, brings a lot of morality issues that questions God’s authority as the creator of everything. In Ecclesiastes 7:13, that says, “Consider Gods handiwork. who can straighten, what He hath made crooked?” poses the question of the extent to which man, being given intellect and will, can tamper on God’s plans by using technology to change what God has already designed. This is viewed in two ways by society. First of which would be the fact that before everything else came to life, God has already planned out one’s whole existence, Him being the creator of everything makes us His property and mere custodian of our bodies. However, for those who believe that the ultimate purpose of creation would be to achieve Utopia, would see technology as a gift from God to allow one to escape suffering and deem genetic engineering appropriate.

&nbsp.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Gay Marriage The Essay Is To Be 7 Pages With

I will pay for the following essay Gay marriage. The essay is to be 7 pages with three to five sources, with in-text citations and a reference page.

In order to comprehend the various issues concerning the debate, it is important to analyze the evolution of the social movement for same-sex marriage in the U.S. and the political and religious controversies surrounding it. Whereas there have been several supporters for the same-sex marriage who argue that the individual should be given freedom to practice same-sex marriage and parenting, the social, religious and secular scholars dealing with the topic challenge the growing pressure to approve same-sex marriage in the contemporary society. Some of the most popular proponents against same-sex marriage maintain that any attempt to affirm this practice will definitely alter the meaning of marriage and family forever. As Glenn T. Stanton argues, “Marriage is and always has been about brining men and women together in permanent, exclusive sexual relationships. No human society – not one – has ever embraced homosexual marriage. It is not a part of the tradition of any human culture… Homosexual unions, married or otherwise, have never been regarded as a normal, morally equal part of any society.” (Stanton, 4) Therefore, a reflective exploration of the question under discussion confirms that same sex marriage is an unacceptable practice which damages our society as it causes of social problems and problems with children and all the major religions of the world oppose same sex marriage. This paper undertakes a profound investigation of the religious and social controversies concerning same sex marriage in order to bring out the issues relating to society, family, and parenting in the background of religious opposition to the practice.

One of the fundamental arguments against the practice of same-sex marriage has been that all the major religious traditions of the world, including Christianity, Judaism, and Islam, are opposed to the permissibility of the same-sex

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Gender And Sexual Studies The Essay Is To Be

I will pay for the following essay Gender and Sexual Studies. The essay is to be 8 pages with three to five sources, with in-text citations and a reference page.

Download file to see previous pages…

Honestly, sometimes it seems like sexuality is a very complex topic of study in the gender relations. However, married men, for example, are often bombarded on a day-to-day basis by conflicting messages and experiences such as you are handsome, you are not handsome (Beasley 123). Women, on the other hand, experience the same compliments like you are not sexy, and you are sexy. Additional conflicting sexuality messages and exceptions to the women include married couple have the worst sex, sex is for your husband, sex is for you and lastly married couples tend to have the best sex complement. Honestly, it is always good to leave women with a smile on their faces, dismay and confusion on their minds. This is embracing sexuality. In the business interactions, everyday stress and fatigue of the libido-suppressing effects, it becomes necessary for people to leave the whole of this “sexuality thing” for another day (Brownson 145). Embracing sexuality as an aspect of socialization is not bad though it should have some limits.

When it comes to sexual pleasure, embracing sexuality encourages the best way possible for the married couple to experience sexual pleasure. Additionally, embracing sexuality in the marriage incidence ensures that the marriage partners cordially respect one another. Even though the embracement of sexuality to some degree seems stacked against every married couple personality, sexologists encourage people not to give up or let go of innately driven sex persuasion and intimacy in their marriages.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Gender Inequalities Within The Nhs The Essay

I will pay for the following essay Gender inequalities within the NHS. The essay is to be 4 pages with three to five sources, with in-text citations and a reference page.

Since its inception in 1948, it has improvised its policies and has incorporated better and newer policies for effective functioning. It is a humongous effort to run the NHS smoothly and efficiently as it has innumerable people involved in its administration and operation. It has gone a step ahead and has integrated computers for better functioning and also has its helpline on the internet. Amidst all these progressive steps, the main factor that remains important for it being effectual is its colossal staff.

The UK government has ensured that almost all doctors and nurses in the UK are employed by the NHS and work in their hospitals. The government has also ensured that all the new student doctors train at the NHS after completing medical school and they have provision to accommodate almost 8000 doctors and nurses every year. These new doctors must undergo a two year foundation programme with the NHS to become registered doctors. NHS plays a very critical role in shaping the careers for new doctors and nurses.

NHS has employment policies that promote equality and diversity within the organization and are non-discriminatory about race, caste and gender and disability (Department of Health, 2006). The Gender Equality Act of 2006 has made provisions for the following: equal opportunities for men and women in terms of employment, no sexual discrimination towards the transsexuals, no pay gap between male and female employees, part time work options and to provide training and up gradation of knowledge and skills. It has been acknowledged by most that there is predominance of women in the nursing field especially those working part-time. There is however, a deliberation that the women nurses are at the lower stratum of the profession, which questions the Equality policy. Studies are showing that female nurses are receiving disproportionate employment opportunities with most of

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Gender Messages Presented On The Television S

I will pay for the following essay Gender messages presented on the television show…FRIENDS. The essay is to be 2 pages with three to five sources, with in-text citations and a reference page.

While an equality of value was managed between the gender, the associations between socio-economic status, gender, and character were a clear message that provides an interesting commentary on the modern society of the period.

The show friends ran between the years 1994 and 2004 (IMDB). The show was comprised of six characters, three of which were women and three of which were men. The traditional roles of males and females was maintained through a modern perspective throughout the show, with the women being both involved in the workplace and representing common female characteristics, as well as men who represented commonly held stereotypes of male gender characteristics. The characters were not only divided by gender, but through socio-economic status. Rachel, Ross, Monica, and Chandler came from affluent backgrounds, where Joey and Phoebe came from working class backgrounds. Rachel, Phoebe, and Joey were in a lower economic class in the beginning of the show, where Monica, Ross and Chandler were in a higher economic class, although their friendship placed them all within the same social class.

Phoebe, the free spirit of the group, is ethereal and strange sometimes, and her sexuality while present is also enigmatic as she never engages in a relationship with any of the other characters. Joey is the male counterpart to Phoebe, an inspiring actor who is also a sexual predator in the sense that he has no aspiration for more than a short term relationship. Although not the kind of boy to bring home to your mom, he lacks the intelligence level to form bad intentions, which also serves to ‘explain’ his lack of monetary success. Chandler works in a corporate environment, but the nature of his job is never clarified which is a running joke on the show and also a commentary on modern corporate life as a ‘cog’ in the works. Ross is

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Gene Prediction The Essay Is To Be 2 Pages Wi

I will pay for the following essay Gene Prediction. The essay is to be 2 pages with three to five sources, with in-text citations and a reference page.

This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039.

The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%.

Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3

ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA.

Fasta formatted sequence was

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay General Custer S Last Stand The Essay Is To B

I will pay for the following essay General Custer’s Last Stand. The essay is to be 4 pages with three to five sources, with in-text citations and a reference page.

Those that were left would pass down the story of the battle from generation to generation, until it became a legendary part of history.

The main controversies leading to the battle were a band of what was considered to be renegade Sioux Native Americans and the fact that the settlers were once again pressing in on the lands previously given to the Sioux. A treaty was signed in 1868 and the Great Sioux Reservation was created. it included the Black Hills, lands considered sacred to the tribe2. Custer himself, however, had led expeditions into the country in 1874 and discovered rich reins of gold, which, of course, were wanted by everyone other than the Sioux3. Complicating things were a band of Sioux that had never considered themselves reservation Native Americans, and lived freely on buffalo hunting grounds4. Led by Chief Sitting Bull, these Sioux were finally issued an ultimatum, which was to move to the reservation by January 31, 1876, or be considered hostile and have military action taken against them5. The stage was set for a spectacular finish, and the Native Americans would not go quietly.

Accounts of Custer himself are conflicted. His own writings depict that he believed Native Americans were hostile, and that they would break any treaty made before the ink was dry from their marks6. However, there are other accounts that portray him as friendly towards the Native Americans, wishing nothing more than to be considered a frontiersman7. It cannot be denied that he had clashed with Native American tribes before, as he had achieved victory over Cheyenne tribe at the Battle of the Washita in 18688. He had also done battle with Sitting Bull, as well as Sioux Chief Crazy Horse in 1873, when guarding railroad workers’ surveying land for new tracks at the Yellowstone River9. Custer, Crazy Horse, and Sitting Bull would once

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Geographical Implications In The A River Runs

I will pay for the following essay Geographical Implications in the A River Runs Through It. The essay is to be 5 pages with three to five sources, with in-text citations and a reference page.

This paper illustrates that the movie ‘A River Runs Through It’set features a number of spectacular geographical backgrounds that would amaze even the hard-hearted. One of these spectacular scenes that I just have to begin with is the part where the two brothers are fly-fishing. The producers made the best out of these amazing geographical scenes by using a combination of effective camera positioning to capture the background and adjacent lighting. As included in the original novel written by Norman MacLean back in 1976, the film claims to have been acted on the Blackfoot River in Montana, a geographical feature stretching from the continental divide in Lewis all the way to Clark Fork covering an average of 120 kilometers. Though this is not necessarily included in the movie, the river draws its waters from both springs and snow water further up in western Montana. The setting of the movie particularly the fly fishing scene displays one of the geographical features that are common with rivers: erosion. We see that most of the riverbank is covered with smoothened rocks ranging from small rocks to large ones. This can be attributed to the rivers’ erosive nature during transportation be it due to hydraulic action, abrasion or corrosion, corrosion or attrition. The production team in this movie was probably motivated by the fact that other than the information received from the cast, the environment would also be in a position to ‘show off’ and reveal a beautiful nature vested in our country. Moving on to yet another spectacular scene chosen by the production team, we find geographical features like river rapids being applied when the boys get a little naughty with the boat. The dual in their teenage row down this rigorous river in such movements that depict that the riverbed is not regular. this is because of the rapids below. These geographical features are common in riverbeds as the flow moves downstream.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Geographical Information Systems The Essay Is

I will pay for the following essay Geographical Information Systems. The essay is to be 4 pages with three to five sources, with in-text citations and a reference page.

The most important part of a GIS is the ‘gencode’ to which information is connected. It represents a geographical code to highlight a place or location anywhere in the world. A GIS shows vital data in a diagrammatic manner, displaying extended spatial locations, territorial divisions, neighborhood vicinities and their inhabitants with unparalleled clearness. The GIS displays structure upon structure of data {such as characteristics and statistics of human population, income levels, voting preferences, poverty levels, pollution rates, and Internet availability}, and the manner in which all structures work in cohesive unity. The GIS user then selects the data to structure according to the queries that need to be solved.

The precise information provided by GIS is being increasingly used for public safety purposes. Public safety officials have discovered that its geospatial information is derived much more spontaneously, and is more productive as compared to data supplied by ambiguous orthodox photography due to the very fast rate at which imagery of a certain area can be displayed as well as the cost savings involved. It is estimated that GIS use has resulted in cutting short land-use and field visits by as much as 70%. Tasks like on-the-way and on-the-scene skillful planning, highlighting the precise origin of wireless calls, advance planning of interior safety and security strategies, and re-directing traffic in times of emergencies have become much easier to undertake and solve more quickly and efficiently (Earth Imaging Journal, 2005).

The use of GIS as a crime-fighting tool is increasing in the United States. It enables the police to examine and evaluate crime trends and find precise geographic locations where some crimes are concentrated, connect those crimes to the area in which they take place, and highlight the locations

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW

I Will Pay For The Following Essay Geographical Scale The Essay Is To Be 5 Pages

I will pay for the following essay Geographical scale. The essay is to be 5 pages with three to five sources, with in-text citations and a reference page.

Download file to see previous pages…

With this definition, this paper then aims to look into how themes of geographical scale actually manifest itself in the organizing of one of the most popular coalition of workers in the United States, the Coalition of Immokalee Workers. Specifically, this paper would try to look into two specific examples wherein themes of geographical scales would be present, especially on the organizing, public information and policy campaigns actually done by the CIW. In addition, this paper would also try to briefly compare and contrast the experiences of the CIW with another group of workers described in Chapter 7 of Tanya Basok’s Book “Tortillas and Tomatoes: Transmigrant Mexican Harvesters in Canada.” By using two specific examples, this paper would try to identify common and differentiated themes of geographic and social aspects in the organizing of these two labor groups. Looking at the regional scale of the United States and Canada, it can be seen that historically, organizations of farm laborers have been relatively weak, as compared to other geographical spaces. …

These workers, who were struggling for higher wages and better working conditions, were actually the ones supplying tomatoes to one of the United State’s widest and most popular food chains, the Taco Bell (“Immokalee: from Slavery to Freedom”). One of the concrete manifestations of geographical scale made by the CIW is their organizing work among the workers itself, putting into the Florida map the formerly unknown Immokalee labor Center, which happened to be the largest agricultural labor center in the state of Florida (“Immokalee: from Slavery to Freedom”). In this illustration, the organizing of the workers themselves into a large coalition actually showed themes of geographical scale, reflecting the organizational reach that the CIW attained in organizing the workers in the tomato fields of southeastern Florida. making them known by conducting strikes and worker barricades in order to show their grievances. Before the organizing of the workers themselves, the Immokalee was formerly absent in the map (“Immokalee: from Slavery to Freedom”), and by forming the CIW, elements of organizational reach, along with elements of political and socio-economic themes suddenly manifested itself. In this case, it is important to note the fact that within geographical spaces, there are actual scopes of conflict. and the outcome or solutions of such conflict may result into situations that may affect processes in other geographical scales (Schattschneider 1960).

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
ORDER NOW