- Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
-
- aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
-
- aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"
